deposited data raw gene microarray data (TaKaRa)

TaKaRa is a verified supplier

TaKaRa manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

TaKaRa deposited data raw gene microarray data
Deposited Data Raw Gene Microarray Data, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 11010 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/deposited+data+microarray+data/TB+Green+Premix+Ex+Taq/pm30067981-234-203-201
Average 99 stars, based on 11010 article reviews

deposited data raw gene microarray data - by Bioz Stars, 2026-10

99/100 stars

Images

Recombinant:

Article Title: Adaptive Fibrogenic Reprogramming of Osteosarcoma Stem Cells Promotes Metastatic Growth.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Fibronectin BD Cat# 610077; RRID: AB_2105706 Fibronectin SANTA CRUZ Cat# sc-9068; RRID: AB_2105699 COL-1 SIGMA-ALDRICH Cat# C2456; RRID: AB_476836 S100A4 abcam Cat# ab27957; RRID: AB_2183775 p-Src Cell signaling Cat# 2101; RRID: AB_331697 Src Cell signaling Cat# 2109; RRID: AB_2106059 p-Paxillin Cell signaling Cat# 2541; RRID: AB_2174466 Paxillin Cell signaling Cat# 2542; RRID: AB_10693603 Vimentin SANTA CRUZ Cat# sc-6260; RRID: AB_628437 aSMA SIGMA-ALDRICH Cat# A5228; RRID: AB_262054 Integrin-b3 Cell signaling Cat# 4702; RRID: AB_2296320 Integrin-b3 abcam Cat# ab119992; RRID: AB_10903329 p-CDK2 Cell signaling Cat# 2561; RRID: AB_2078685 GAPDH Cell signaling Cat# 5174; RRID: AB_10622025 p-Cyclin E Cell signaling Cat# 4136; RRID: AB_2071080 HCAM SANTA CRUZ Cat# SC-7946; RRID: AB_2076217 FGF Receptor MILLIPORE Cat# MAB125; RRID: AB_2103537 FGFR1 Cell signaling Cat# 3472; RRID: AB_2103374 FGFR2 Cell signaling Cat# 11835 FGFR3 Cell signaling Cat# 4574; RRID: AB_2246903 FGFR4 Cell signaling Cat# 2894; RRID: AB_2293993 E2F-1 BD Cat# 554213; RRID: AB_395308 SSEA-4 R&D Cat# FAB1435P; RRID: AB_357038 SSEA-4 MILLIPORE Cat# MAB4304; RRID: AB_177629 SSEA-4 R&D Cat# MAB1435; RRID: AB_357704 p27 SANTA CRUZ Cat# sc-528; RRID: AB_632129 p21 Cell signaling Cat# 2947; RRID: AB_823586 Ki-67 EPITOMICS Cat# 2746-1; RRID: AB_2142233 RB BD Cat# 554136; RRID: AB_395259 p-S6K Cell signaling Cat# 9205; RRID: AB_330944 S6K Cell signaling Cat# 9202; RRID: AB_331676 p-AKT Cell signaling Cat# 2965; RRID: AB_2255933 AKT Cell signaling Cat# 4685; RRID: AB_2225340 p-ERK Cell signaling Cat# 4370; RRID: AB_2315112 ERK Cell signaling Cat# 4695; RRID: AB_390779 p-S6 Cell signaling Cat# 2211; RRID: AB_331679 S6 Cell signaling Cat# 2317; RRID: AB_2238583 Oct-3/4 R&D Cat# MAB1759; RRID: AB_2167713 Nanog Cell signaling Cat# 4893; RRID: AB_10548762 p-Smad3 Cell signaling Cat# 9520; RRID: AB_2193207 FITC-Ki67 BD Cat# 556026; RRIA: AB_396302 APC-BrdU BD Cat# 556028; RRID: AB_396304 Alexa Fluor 488 Jackson ImmunoResarch Cat# 711-545-152; RRID: AB_2313584 (Continued on next page) e1 Cell Reports 24, 1266–1277.e1–e5, July 31, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Cy3 Jackson ImmunoResarch Cat# 715-165-150; RRID: AB_2340813 Anti-b-Actin SIGMA-ALDRICH Cat# A1978; RRID: AB_476692 Anti-Rabbit IgG Peroxidase Conjugate Calbiochem Cat# 401315 Anti-Mouse IgG Peroxidase Conjugate Calbiochem Cat# 401215 GFP Cell signaling Cat# 2956; RRID: AB_1196615 Chemicals, Peptides, and Recombinant Proteins N-2 R&D Cat# AR003 FGF R&D Cat# 233-FB EGF R&D Cat# 236-EG IGF-1 R&D Cat# 291-G1 PDGF-BB R&D Cat# 220-BB LIF MILLIPORE Cat# LIF1005 TGF-b R&D Cat# 240-B B27 GIBCO Cat# 17504 activin A R&D Cat# 338-AC SU5402 Calbiochem Cat# 572630 RAD001 Novartis Pharma N/A LY294002 Calbiochem Cat# 440202 Triton X-100 SIGMA-ALDRICH Cat# X-100 D-luciferin, Potassium Salt Sciencelight Cat# 201105 DMSO SIGMA-ALDRICH Cat# D2650 Doxycycline Clontech Cat# 631311 Puromycin Clontech Cat# 631305 Trizol Invitrogen Cat#15596018 DMEM Invitrogen Cat# 11995 RPMI 1640 Invitrogen Cat# 11875 Trypsin Invitrogen Cat# 25200-072 OPTI-MEM Invitrogen Cat# 31985-070 Fetal bovine serum Invitrogen Cat# 10099-141 Nintedanib Selleck Cat# S1010 Pirfenidone Selleck Cat# S2907 Critical Commercial Assays ImmobilonTM Western Chemiluminescent HRP Substrate MILLIPORE Cat# WBKLS0500 Dynabeads M-280 Sheep Anti-Mouse IgG Invitrogen Cat# 11201D MOUNTING MEDIUM VECTOR Cat# H-1200 Apoptosis Detection Kit BD Cat# 556547 Anti-Human Ki-67 Set BD Cat# 556026 Senescence Detection Kit abcam Cat# Ab65351-250 Anti-BrdU Set BD Cat# 556028 SYBR Premix ExTaq kit Takara Cat#RR420A Deposited Data Raw gene microarray data This paper GEO: GSE85537 Experimental Models: Cell Lines Human osteosarcoma cell line MG63 Shanghai Institute of Hematology MG63 Human osteosarcoma cell line Well5 Shanghai Institute of Hematology Well5 Human osteosarcoma cell line Saos2 Shanghai Institute of Hematology Saos2 Human osteosarcoma cell line U2OS Shanghai Institute of Hematology U2OS Human breast cancer cell line MCF-7 Shanghai Institute of Hematology MCF-7 (Continued on next page) Cell Reports 24, 1266–1277.e1–e5, July 31, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human pancreatic cancer cell line PANC-1 Shanghai Institute of Hematology PANC-1 Human liver cancer cell line HepG2 Shanghai Institute of Hematology HepG2 Human liver cancer cell line 7402 Shanghai Institute of Hematology 7402 Human pancreatic cancer cell line SW1990 Shanghai Institute of Hematology SW1990 Experimental Models: Organisms/Strains NOD/SCID mice Shanghai SLAC Laboratory NOD/SCID Oligonucleotides sg1: AGCCCGGGCCAATCGGCGCG Shanghai Genechem Cat# V20161209006 sg2: CAGTCCCCCGTGACGTCACC sg3: CGGGGCGGGGACAGCCCGGC FN1-shRNAs Shanghai Genechem Cat# GCIL922416 #1 50-CGTGGTTGTATCAGGACTTAT-30 #2 50-GCCTGCTCCAAGAATTGGTTT-30 #3 50-CCCTACACAGTTTCCCATTAT-30 FGFR2-shRNAs Shanghai Genechem Cat# V20161110022 #1 50-CAACCTCTCGAACAGTATT-30 #2 50-CAACAATAGGACAGTGCTT-30 #3 50-CACCAACCAAATACCAAAT-30 FN primer Sangon Biotech N/A 50-CCA CCC CCA TAA GGC ATA GG-30 and 50-GTA GGG GTC AAA GCA CGA GTC ATC-30 Software and Algorithms FlowJo software TreeStar N/A Image Reader LAS-4000 FUJIFILM N/A Leica TCS SP8 Leica https://www.leica-microsystems.com/ products/confocal-microscopes/details/ product/leica-tcs-sp8/ GraphPad Prism GraphPad Software http://www.graphpad.com/prism/ Excel 2010 Microsoft N/A Summit software Beckman coulter http://www.beckmancoulter.cn/ls- discovery/flow.aspx Other Normal Donkey Serum Jackson ImmunoResarch Cat# 017-000-121

Western Blot:

Microarray:

Article Title: Repression of Cell Differentiation by a cis-Acting lincRNA in Fission Yeast.
Article Snippet: .. Current Biology 28, 1–9, February 5, 2018 9 STAR+METHODS KEY RESOURCES TABLE REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-HA Sigma H6908 PAP Sigma P1291 Ant-GST Sigma T5168 Anti-PolII Covance MMS-126R Anti-H3 Abcam 1791 Anti-H3 K14-ac Millipore 07-353 Anti-H3K4me3 Millipore 07-473 Anti-H3K4me2 Millipore 07-030 Critical Commercial Assays Q5 mutagenesis kit New Englands Biolabs E0554 RNeasy QIAGEN 74104 RNA-to-cDNA Thermo 4387406 M-MLV RT Invitrogen 28025013 Dynabeads Thermo 11041 GST purification kit Thermo 25239 Ribomax T7 in vitro transcription kit Promega P1300 SMARTer RACE Clonetech 634858 MyOne streptavine beads Thermo 65601 Deposited Data Microarray data GEO GSE89825 Experimental Models: Organisms/Strains Fission yeast strains N/A See Data S4 Oligonucleotides Oligonucleotides IDT See Data S3 Software and Algorithms GraphPad Prism N/A https://www.graphpad.com/scientific-software/prism/ PodBat N/A https://omictools.com/podbat-tool ApE N/A http://biologylabs.utah.edu/jorgensen/wayned/ape/ CONTACT FOR REAGENT AND RESOURCE SHARING Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Damien Hermand (Damien.Hermand@unamur.be). ..

Mutagenesis:

Purification:

In Vitro:

Software:

other:

Article Title: yylncT Defines a Class of Divergently Transcribed lncRNAs and Safeguards the T-mediated Mesodermal Commitment of Human PSCs.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HSA NeoFroxx Cat# 05-750-1B CD Lipids Thermo Fisher Scientific Cat# 11905031 ITS Corning Cat# 25-800-CR FGF Preprotech Cat# 100-18B-1000 Activin A eBioscience Cat# 34-8993-85 TGFb eBioscience Cat# 34-8348 Dorsomorphin Tocris bioscience Cat# 3093 KO DMEM Thermo Fisher Scientific Cat# 10829018 L-Glutamine Thermo Fisher Scientific Cat# 25030024 KO DMEM Thermo Fisher Scientific Cat# 10829018 PENICILLIN STREPTOMYCIN Thermo Fisher Scientific Cat# 15140122 L-Glutamine Thermo Fisher Scientific Cat# 25030024 Transferrin Sigma Aldrich Cat# T8158-1G Selenite Sigma Aldrich Cat# S5261-10G Ascorbic Acid Sigma Aldrich Cat# 49752-10G Bromophenol blue Roth Cat# 5429.2 DTT (dithiothreitol) VWR Cat# 27808.366 Glycerol Ambion Cat# AM9260G TRIS base Roth Cat# 5429.2 Sodium Chloride (NaCl) VWR Cat# 27808.366 NP-40 Alternative CALBIOCHEM Cat# 492016 10% Sodium Dodecylsulfate (SDS) Solution Promega Cat# V6551 Sodium deoxycholate Applichem Cat# A1531,0025 Protease Inhibitor Cocktail EDTA-free Thermo Fisher Scientific Cat# A32955 RNase Inhibitor, Murine NEB Cat# M0314 Sodium Chloride (NaCl) VWR Cat# 27808.366 0.5 M EDTA pH 8 Ambion Cat# AM9260G 1,4-Dithiothreitol (DTT) VWR Cat# 44383B Magnesium Chloride Ambion Cat# AM9530G Tween 20 (Polysorbate) Millipore Cat# 8.17072.1000 Critical Commercial Assays TUNEL assay kit (DeadEnd Fluorometric TUNEL System) Promega Cat# G3250 DNMT Activity / Inhibition Assay Active Motif Cat# 55006 STEMdiff Trilineage Differentiation Kit Stem Cell technologies Cat# 05230 EZ DNA Methylation Gold kit Zymo Research Cat# D5005 mMESSAGE mMACHINE T7 Ultra Kit Thermo Fisher Scientific Cat# AM1345 SMARTer RACE 50/30 Kit TaKaRa Cat# 634859 Deposited Data Human total RNA-Seq, human PolyA RNASeq and mouse total RNA-Seq This Paper GEO: GSE115671 CHOP-MS data This Paper Table S4 Microarray data This Paper Table S4 Experimental Models: Cell Lines Human: WA01 (H1 human ESCs) WiCell, Madison, Wisconsin hPSCReg ID WAe001-A RRID:CVCL_9771 Human: HuES6 (human ESCs) Boris Greber Lab, Max Planck Institute for Molecular Medicine (Muenster, Germany) RRID:CVCL_B194 (Continued on next page) e2 Cell Stem Cell 24, 1–10.e1–e8, February 7, 2019

Review